Transformation génétique sur graines Phyllostachys Edulis

Fiche de culture des semis
Répondre
VinceDel
Maître Bambou
Messages : 9687
Enregistré le : 30 juil. 2018, 15:30
Plantation : Jardin
Surface : 500
Orientation : Sud
Sol : Argileux
Code postal : 59
Ville : Près de Lille
A remercié : 2516 fois
A été remercié : 3728 fois

Transformation génétique sur graines Phyllostachys Edulis

Message par VinceDel »

Un article super intéressant sur la transformation génétique des graines de Phyllostachys Edulis. Pour la traduction, Google est ton ami. Pour le vocabulaire inconnu, bin, faites comme moi, Google est aussi ton ami.
https://www.frontiersin.org/articles/10 ... uto-dlvrit


Je taille et coupe au sécateur BAHCO 😁🤣
Avatar du membre
strike88
Esprit Bambou
Messages : 2758
Enregistré le : 09 nov. 2008, 11:56
Plantation : Jardin
Surface : 1300
Orientation : Sud
Sol : Argileux
Code postal : 4621
Ville : Retinne
A remercié : 193 fois
A été remercié : 202 fois

Re: Transformation génétique sur graines Phyllostachys Edulis

Message par strike88 »

Après traduction en français , y a t'il la traduction de scientifiques à profane Yellow_Hot_Colorz_PDT_07
Si j'ai bien compris,il s'agit de multiplication in-vitro a partir de graines ?

Image


VinceDel
Maître Bambou
Messages : 9687
Enregistré le : 30 juil. 2018, 15:30
Plantation : Jardin
Surface : 500
Orientation : Sud
Sol : Argileux
Code postal : 59
Ville : Près de Lille
A remercié : 2516 fois
A été remercié : 3728 fois

Re: Transformation génétique sur graines Phyllostachys Edulis

Message par VinceDel »

strike88 a écrit : 20 févr. 2022, 22:01 Après traduction en français , y a t'il la traduction de scientifiques à profane Yellow_Hot_Colorz_PDT_07
Si j'ai bien compris,il s'agit de multiplication in-vitro a partir de graines ?

Image
Oui, à partir du moment où il y a une modification génétique, je pense que l'on peut parler d'expérience in vitro.


Je taille et coupe au sécateur BAHCO 😁🤣
Avatar du membre
strike88
Esprit Bambou
Messages : 2758
Enregistré le : 09 nov. 2008, 11:56
Plantation : Jardin
Surface : 1300
Orientation : Sud
Sol : Argileux
Code postal : 4621
Ville : Retinne
A remercié : 193 fois
A été remercié : 202 fois

Re: Transformation génétique sur graines Phyllostachys Edulis

Message par strike88 »

Cette vidéo qui m'a toujours intrigué.
Ces la troisième plus ancienne vidéo de la chaîne de chez only.
https://youtu.be/bO2WHHMW8ro
Donc Newfi avait peut-être moyennement raison en affirmant qu'ils ne multipliaient pas par in-vitro?
C'est peut être là que se fait la fameuse sélection?
Donc in-vitro, mais à partir de graines pour garantir une floraison la plus tardive. possible.


VinceDel
Maître Bambou
Messages : 9687
Enregistré le : 30 juil. 2018, 15:30
Plantation : Jardin
Surface : 500
Orientation : Sud
Sol : Argileux
Code postal : 59
Ville : Près de Lille
A remercié : 2516 fois
A été remercié : 3728 fois

Re: Transformation génétique sur graines Phyllostachys Edulis

Message par VinceDel »

strike88 a écrit : 20 févr. 2022, 23:21 Cette vidéo qui m'a toujours intrigué.
Ces la troisième plus ancienne vidéo de la chaîne de chez only.
https://youtu.be/bO2WHHMW8ro
Donc Newfi avait peut-être moyennement raison en affirmant qu'ils ne multipliaient pas par in-vitro?
C'est peut être là que se fait la fameuse sélection?
Donc in-vitro, mais à partir de graines pour garantir une floraison la plus tardive. possible.
J'avais déjà vu cette vidéo, mais je l'avais complètement oublié.
L'in vitro est une transformation génétique qui peut avoir différentes formes. Sur les fargesia Oprins il me semble qu'il partent sur des cellules souches qu'ils modifient et réveillent afin d'obtenir une germination qui donc se transforme en plant. Ici ils partent même de graines non viables qu'il modifient et réveillent afin donc d'obtenir une germination et qui donc se transforme en plant aussi.
Il faut que je relise car j'ai zappé l'histoire de garantir une floraison la plus tardive possible, j'y voyais plus une sélection des meilleurs plants.
Oui, il me semble que Newfi avait parlé d'un contrat de monopole de only moso pour racheter la totalité des graines dd moso, mais je ne sais plus avec qui. Mais je pense comme toi, leur sélection de plants doit être fait à peu près de cette façon là. Activer ou accentuer la levée des graines par ce procédé.
Après vu les tarifs bas, ils peuvent aussi racheter l'intégralité des graines pour conserver un monopole et être seul sur le marché.


Je taille et coupe au sécateur BAHCO 😁🤣
Avatar du membre
strike88
Esprit Bambou
Messages : 2758
Enregistré le : 09 nov. 2008, 11:56
Plantation : Jardin
Surface : 1300
Orientation : Sud
Sol : Argileux
Code postal : 4621
Ville : Retinne
A remercié : 193 fois
A été remercié : 202 fois

Re: Transformation génétique sur graines Phyllostachys Edulis

Message par strike88 »

Ne cherche pas pour la floraison tardive, c'est mois qui suppose que c'est pour ça qu'ils partent de graines :wink:


VinceDel
Maître Bambou
Messages : 9687
Enregistré le : 30 juil. 2018, 15:30
Plantation : Jardin
Surface : 500
Orientation : Sud
Sol : Argileux
Code postal : 59
Ville : Près de Lille
A remercié : 2516 fois
A été remercié : 3728 fois

Re: Transformation génétique sur graines Phyllostachys Edulis

Message par VinceDel »

strike88 a écrit : 21 févr. 2022, 10:40 Ne cherche pas pour la floraison tardive, c'est mois qui suppose que c'est pour ça qu'ils partent de graines :wink:
Ah d'accord, ce doit être l'effet de la Orval ou de la triple Karmeliet du week-end... Tu as vu des floraisons qui s'eloignaient 😁😁😁


Je taille et coupe au sécateur BAHCO 😁🤣
Avatar du membre
strike88
Esprit Bambou
Messages : 2758
Enregistré le : 09 nov. 2008, 11:56
Plantation : Jardin
Surface : 1300
Orientation : Sud
Sol : Argileux
Code postal : 4621
Ville : Retinne
A remercié : 193 fois
A été remercié : 202 fois

Re: Transformation génétique sur graines Phyllostachys Edulis

Message par strike88 »

Je veux dire que, si c'est pour faire de la multiplication in-vitro, mieux vaux partir de graines, ( ce qui garantirais un cycle de floraison entier) que de partir d'un moso ou autre phyllostachys non issus de semis récent qui risquerait de fleurir dans les prochaines années.
Mais je pense que je me trompe, et que cette expérience n'est pas faite dans un but productif, juste une expérience comme ça ?


Avatar du membre
albert
Maître Bambou
Messages : 7415
Enregistré le : 11 juil. 2009, 06:37
Plantation : Jardin
Surface : 1000
Orientation : Nord
Sol : Limoneux
Code postal : 95
Ville : A coté de Pontoise
A remercié : 375 fois
A été remercié : 652 fois

Re: Transformation génétique sur graines Phyllostachys Edulis

Message par albert »

Encore un sujet intéressant. Faut que je prenne le temps de lire traduire et dictionnairer pour comprendre.
C'est quand même dingue que la "technologie" bambou botanistique ne soit lisible qu'en langue anglaise. Mais non de dla, on n'a pas de botaniste chevronnés made in cocorico qui pourrait écrire et transmettre leur savoir? Certes, les "gens" intéressés ne représentent qu'une petite niche, mais ils existent. Tient on se croirait dans le milieu médical, où tout se publie en schpounz.
C'est le coup de grogne de tonton Albert. Plates excuses. Grr.


Avatar du membre
strike88
Esprit Bambou
Messages : 2758
Enregistré le : 09 nov. 2008, 11:56
Plantation : Jardin
Surface : 1300
Orientation : Sud
Sol : Argileux
Code postal : 4621
Ville : Retinne
A remercié : 193 fois
A été remercié : 202 fois

Re: Transformation génétique sur graines Phyllostachys Edulis

Message par strike88 »

Voilà un copier coller traduit mais sans les photos
Quand tu est sur la page, tu peux traduire facilement.
Moi avec mon smartphone, je clic sur les 3 petit point au dessus a droite et ensuite " traduire"

Logo Frontières
CONNEXION
/
S'INSCRIRE
SUR
JOURNAUX
SUJETS DE RECHERCHE
DES ARTICLES
NOUS FAIRE PARVENIR
Facteur d'impact 5,753 | CiteScore 8.2 En
savoir plus sur l'impact ›

en sciences végétales
BASCULER LA NAVIGATION


Suggérer un sujet de recherche >


607VUES TOTALES

Article de recherche original
De face. Plant Sci., 11 février 2022 | https://doi.org/10.3389/fpls.2022.822022
Une transformation génétique efficace et un système d'édition du génome basé sur CRISPR/Cas9 pour le bambou Moso ( Phyllostachys edulis )
Biyun Huang 1,2† , Renying Zhuo 1,2† , Huijin Fan 1,2 , Yujun Wang 1,2 , Jing Xu 1,2 , Kangming Jin 1,2 et Guirong Qiao 1,2*
1 State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Pékin, Chine
2 Key Laboratory of Tree Breeding of Zhejiang Province, Research Institute of Subtropical of Forestry, Chinese Academy of Forestry, Hangzhou, Chine
Le bambou Moso ( Phyllostachys edulis ) est l'espèce de bambou monopodiale la plus importante au monde. Sans système de transformation génétique, il est difficile de vérifier les fonctions des gènes contrôlant des traits importants et de mener une sélection moléculaire chez le bambou moso. Ici, nous avons établi un système de régénération végétale à partir d'embryons immatures. Des cals ont été induits sur un milieu MS additionné de 4 à 6 mg⋅L –1 d'acide 2,4-dichlorophénoxyacétique (2,4-D) avec une efficacité élevée (> 60 %). Une combinaison de 0,5 mg⋅L –1 d'acide 1-naphtylacétique (NAA), de 2,0 mg⋅L –1 de 6-benzylaminopurine (BAP) et de 3,0 mg⋅L –1 de zéatine (ZT), un régulateur de croissance des plantes, convenait à la différenciation des pousses, et la fréquence d'induction des pousses a été augmentée à 43 % après 0,5 mg⋅L–1 prétraitement à l'acide abscissique (ABA). Une concentration de dépistage antibiotique efficace a été déterminée par un test de sensibilité à l'hygromycine. Nous avons encore optimisé la concentration d' Agrobacterium et ajouté une infiltration sous vide pour l'infection, ce qui améliore l'efficacité de l'expression transitoire. Un système de transformation génétique a été établi pour la première fois dans le bambou moso, avec une efficacité de transformation d'environ 5 %. Pour optimiser l'édition du génome, deux promoteurs endogènes de petit ARN nucléaire (snRNA) U3 ont été isolés et utilisés pour piloter l'expression du petit ARN guide (sgRNA). Les résultats ont montré que le promoteur PeU3.1 présentait une efficacité plus élevée et qu'il était utilisé pour l'édition ultérieure du génome. Enfin, pds1pds2 homozygoteles mutants ont été obtenus par un système efficace d'édition du génome CRISPR/Cas9. Ces systèmes techniques favoriseront la validation fonctionnelle des gènes et accéléreront le processus de sélection moléculaire du bambou moso.

introduction
Le bambou est une ressource forestière importante avec une superficie mondiale de forêts de bambous de plus de 47 millions de hm 2 et une production annuelle de plus de 500 millions de tonnes de bois de bambou ( Li et Fu, 2021 ). Le bambou Moso ( Phyllostachys edulis ) est l'espèce de bambou ligneux la plus importante sur le plan économique et joue un rôle économique et écologique essentiel. Cette espèce se caractérise par une reproduction asexuée, une croissance rapide et une grande capacité de fixation du carbone ( Zhou et al., 2011 ). Récemment, une analyse de 427 génomes a révélé la faible diversité génétique de la population de bambou moso, ce qui indique que cette espèce peut avoir une faible taille de population effective et un petit pool génétique pouvant être utilisé à des fins de reproduction futures ( Zhao et al., 2021). Malheureusement, en raison du cycle de floraison long et imprévisible du bambou, il est difficile d'obtenir de nouvelles variétés par croisement. Par conséquent, l'identification des gènes contrôlant les caractéristiques importantes du bambou et l'utilisation de la sélection moléculaire pour améliorer les variétés sont les méthodes qui peuvent être utilisées pour obtenir rapidement de nouvelles variétés.

Le génome du bambou moso a été libéré ( Peng et al., 2013 ) et assemblé au niveau des chromosomes ( Zhao et al., 2018 ), ce qui permet des avancées majeures dans la compréhension des plantes de bambou. À ce jour, les mécanismes des traits critiques qui incluent la formation des fleurs, la croissance rapide, la croissance de l'épaississement primaire des pousses et la lignification chez le bambou moso ont principalement été révélés par les omiques ( Ge et al., 2017 ; Wei et al., 2017 ; Wang et al. , 2021 ; Yang et al., 2021). De nombreux gènes candidats ont été identifiés, mais il n'y a eu aucune vérification fonctionnelle d'aucun gène du bambou moso en raison de l'absence d'un système de transformation génétique. Les systèmes de régénération végétale du bambou ont principalement été signalés chez des espèces de bambou sympodial. Depuis le premier rapport de régénération végétale à partir d'embryons zygotiques de Bambusa arundinacea ( Mehta et al., 1982 ), des protocoles de régénération végétale ont été menés chez plusieurs espèces sympodiales de bambou à partir d'embryons matures de Dendrocalamus latiflorus , Dendrocalamus strictus et Otatea acuminata aztecorum ( Rao et al., 1985 ; Yeh et Chang, 1987 ; Woods et al., 1992), ou des anthères de Bambusa oldhamii , Bambusa beecheyana var. beecheyana , et D. latiflorus ( Yeh et Chang, 1986a , b ; Tsay et al., 1990 ; Qiao et al., 2013 ). Récemment, des plantules se sont régénérées avec succès à partir d'extrémités de pousses de D. hamiltonii et de jeunes pousses de D. latiflorus ont été signalées ( Zang et al., 2016 ; Ye et al., 2017 ). Il n'y a eu qu'un seul cas signalé d'espèces de bambou monopodiales, qui montre une régénération végétale à partir de cals induite à partir de graines matures de P. edulis ( Yuan et al., 2013). Cependant, les graines matures ont été difficiles à stériliser complètement et pas plus de 5,0% des cals ont pu se régénérer. Un système de transformation génétique n'a été établi que chez le bambou Ma ( Dendrocalamus latiflorus ), qui représente des espèces sympodiales de bambou ( Qiao et al., 2014 ; Ye et al., 2017 ). Le bambou Moso est une espèce de bambou monopodial, qui a des caractéristiques de croissance différentes du bambou sympodial.

L'édition du génome est une nouvelle technologie de génie génétique qui peut modifier avec précision les sites cibles spécifiques du génome. Il comprend principalement les nucléases artificielles à doigt de zinc (ZFN), les nucléases effectrices de type activateur de transcription (TALEN) et les nucléases CRISPR/Cas guidées par ARN (CRISPR) ( Bibikova et al., 2003 ; Bedell et al., 2012 ; Cong et al., 2013). L'édition du génome montre un grand potentiel dans la recherche fondamentale et l'amélioration génétique des cultures. La technologie d'édition du génome de troisième génération, telle que CRISPR/Cas9, présente des avantages incomparables par rapport aux autres technologies d'édition du génome. La protéine Cas9 combinée à un ARN à guide unique peut non seulement jouer le rôle de reconnaissance, mais également effectuer une fonction de coupe et des sites spécifiques à la cible. Le système CRISPR/Cas9, en tant que technologie d'édition efficace spécifique au site génétique, a été appliqué avec succès à Arabidopsis thaliana , au riz ( Oryza sativa ), au maïs ( Zea mays ), au blé ( Triticum aestivum ) et au peuplier ( Populus davidiana × Populus bolleana ) ( Zhang et al., 2016 , 2018; Liang et al., 2017 ; Lee et al., 2018 ; Papikian et al., 2019 ). À l'heure actuelle, la réalisation de l'édition du génome dépend principalement de la régénération des plantes et de la transformation médiée par Agrobacterium . Un système efficace de régénération et de transformation génétique est la prémisse d'une édition efficace du génome. Cependant, il n'y a eu qu'un seul rapport sur l'application de l'édition génétique au bambou. Dans ce rapport, un mutant dlmpsy1 avec un phénotype albinos et un mutant avec une hauteur de plante modifiée ont été générés par CRISPR/Cas9 ( Ye et al., 2020 ).

Les promoteurs du petit ARN nucléaire U3 / U6 (snRNA) avec des sites d'initiation de la transcription A/G sont importants pour la conduite de la transcription du petit ARN guide (sgRNA) dans le système CRISPR/Cas9. Les promoteurs U3 ou U6 à forte activité transcriptionnelle peuvent guider avec précision la transcription de l'ARNsg, de manière à réduire l'effet hors cible causé par la transcription d'ADN non apparenté ( Li et al., 2007 ; Belhaj et al., 2013 ; Cong et al., 2013 ). Des promoteurs endogènes et exogènes U3 / U6 ont été appliqués avec succès pour piloter l'expression de l'ARNsg dans différentes plantes. Cependant, il a été rapporté que l' U3 spécifique à l'espèce/ Les promoteurs U6 sont beaucoup plus efficaces pour piloter la transcription du sgRNA et améliorer l'efficacité d'édition du système CRISRP/Cas9 ( Feng et al., 2013 ; Sun et al., 2015 ; Long et al., 2018 ). Chez le coton, l'efficacité de l'édition du génome a été multipliée par 4 à 6 lorsque l'ARNsg était piloté sous le promoteur endogène GhU6.3 par rapport au promoteur exogène AtU6-29 ( Long et al., 2018 ). L'efficacité de la transcription était également différente entre les promoteurs U3 / U6 d'une même espèce. Les efficacités d'édition de cinq promoteurs U6 endogènes étaient différentes et variaient de 8,47 à 24,92 % enHevea brasiliensis ( Dai et al., 2021 ). Par conséquent, l'identification de promoteurs U3 / U6 endogènes supplémentaires est propice à l'amélioration du système d'édition du génome CRISPR/Cas9. Dans cette étude, nous avons d'abord établi un système de régénération végétale efficace à partir d'embryons immatures et un système de transformation génétique via Agrobacterium tumefaciens dans le bambou moso. Les facteurs qui affectent la régénération des plantes et l'efficacité de la transformation ont été optimisés. Deux promoteurs endogènes d'ARNsn U3 ont été identifiés à partir de bambou moso pour piloter l'expression d'ARNsg, et l'efficacité de l'édition a été comparée au promoteur OsU3 . Enfin, en prenant la rédaction du PePDSgène à titre d'exemple, l'applicabilité d'un système efficace d'édition du génome basé sur CRISPR / Cas9 a été démontrée pour la première fois dans le bambou moso. Ces systèmes techniques favoriseront la validation fonctionnelle des gènes et accéléreront le processus de sélection moléculaire du bambou moso.

Matériels et méthodes
Matières végétales
Immature seeds were collected from a natural flowering moso bamboo forest (25°12′36″E – 110°46′12″N) in Guangxi Zhuang Autonomous Region, China, from July to August. The seeds, which were plump, grayish-green (Figure 1A), were washed under tap water for 2 h and then soaked in 75% ethanol for 1 min. After being sterilized in a 2% sodium hypochlorite solution containing 0.1% Tween-80 for 15–20 min and rinsed with autoclaved distilled water 3–5 times, the embryos (about 1.3 mm in diameter) were extruded from the base of the seeds with a sickle probe on sterile filter paper and placed onto individual 9-cm diameter petri dishes containing 20-ml induction medium (Supplementary Video 1). The calli were induced and proliferated in the dark, whereas shoot differentiation and rooting were conducted at 25°C under a 16 h light/8 h dark photoperiod with a light intensity of 60–70 μmol/m2/s. For callus and shoot induction frequency, three repetitions were set up with 100 explants or calli per replicate. The statistical analysis was analyzed using SPSS software version 22.

FIGURE 1
www.frontiersin.org
Figure 1. Plant regeneration from immature embryo of moso bamboo. (A) Immature seed. (B) Immature embryo. (C) Callus inducted from embryo. (D) Callus proliferation. (E) Plantlet differentiated immediately on the subculture medium. (F) Immature embryos cultured on the induction medium. (G) Calli inducted from embryos on the induction medium for 3 weeks. (H) Calli proliferation on the subculture medium. (I) Shoots induction on the differentiation medium. (J) Rooting and plant regeneration. (K) Regenerated plant was transplanted into soil. (L) Callus induction frequency on MS medium containing 2,4-D 1–6 mg⋅L–1. (M) Shoot induction frequency pretreated by ABA at different concentration of 0–1.5 mg⋅L–1. Different lowercase letters showed significant difference by Tukey’s multiple comparison test, p < 0.05.

Callus Induction and Plant Regeneration From Immature Moso Bamboo Embryos
For callus induction, different concentrations of 2,4-dichlorophenoxyacetic acid (2,4-D) (1, 2, 4, and 6 mg⋅L–1) were supplemented to MS medium (MS basal medium with 30 g⋅L–1 sucrose and 8 mg⋅L–1 agar, pH 5.8). After 3 weeks of induction, light yellow calli were subcultured on MS medium with 0.1–1.0 mg⋅L–1 2, 4-D once every month. Plant growth regulator combinations with different concentrations (0.1, 0.5, and 1.0 mg⋅L–1 1-naphthylacetic acid, NAA, 1, 2, and 3 mg⋅L–1 6-benzylaminopurine, BAP, 1, 3, and 5 mg⋅L–1 zeatin, ZT) were used for shoot induction. To further improve the differentiation efficiency, the calli were pretreated with 0, 1, 0.5, and 1.0 mg⋅L–1 abscisic acid (ABA) in subculture for 1 month and then transferred to shoot induction medium. For root induction, 1/2 MS basal medium supplemented with 2 mg⋅L–1 3-indolebutyric acid (IBA) was used. After induction for 1.5 months, the regenerated plants with 5–7 cm height were transplanted into peat soil and cultivated in a growth chamber at 26°C with a 16-h light/8-h dark photoperiod.

Genetic Transformation Mediated by A. tumefaciens
To test the sensitivity of calli to hygromycin, the calli were cultured on the subculture medium with different concentrations of hygromycin (0, 10, 20, 30, 40, and 50 mg⋅L–1) for 4 weeks. Then, the calli were subcultured on a new medium containing hygromycin for 4 weeks. The callus survival rate was calculated by the ratio of the number of calli that proliferated to the total number of tested calli. In this study, pCAMBIA1305 binary vector containing a 35:GUS expression frame and a plant selectable marker gene HygR was transformed into A. tumefaciens strain EHA105 (Figure 2A). Large white calli were infected in Agrobacterium suspensions with concentrations of OD600 0.2, 0.4, 0.6, 0.8, and 1.0 for 20 min. Vacuum infiltration for 5–15 min was performed at OD600 0.6, and the total infection time was 20 min. After 3 days of coculture on the subculture medium with 100 μmol⋅L–1 acetosyringone (AS), some of the transformed calli were used to test the transient expression frequency through β-glucuronidase (GUS) staining. The remaining calli were transferred to the selected medium with 40 mg⋅L–1 hygromycin and 300 mg⋅L–1 cefotaxime. After subculture and successive screening for 3–4 months, resistant calli were transferred to the shoot induction medium with 25 mg⋅L–1 hygromycin and 300 mg⋅L–1 cefotaxime. After 2–3 months, the hygromycin-resistant shoots were rooted on root induction medium with 300 mg⋅L–1 cefotaxime. The regenerated plantlets were transferred to a greenhouse and tested by GUS staining and PCR (primers: 35S-F: 5′-GACGCACAATCCCACTATCC; GUS-R: 5′-GTTACGAATGACTTTTCCGAGG; 785 bp). The transformation protocol has been provided in the Supplementary Material.

FIGURE 2
www.frontiersin.org
Figure 2. Agrobacterium-mediated transformation of moso bamboo. (A) Schematic representation of key elements of T-DNA in the binary vector pCAMBIA1305. LB, left border; T35S, terminator of CaMV35S; HygR, hygromycin phosphotransferase gene; 2 X p35S, CaMV 35S promoter (enhanced); MCS, multiple cloning sites; p35S, promoter of CaMV35S; GUSPlus,β-glucuronidase gene; Tnos, NOS terminator; RB, right border. (B) Hygromycin sensitivity of calli of moso bamboo. (C) Transient expression frequency and contamination rate of Agrobacterium at different concentration of Agrobacterium. (D) Transient expression frequency and death rate by vacuum infiltration for 5–15 min. Three repetitions were set up with 30 calli per replicate. Different letters on the same series showed significant difference by Tukey’s multiple comparison test, p < 0.05. (E) GUS staining of negative (i) and positive (ii) callus after cocultured 3 days. (F) Transformed callus on selected medium. (G) Positive plant detected by GUS staining. (H) Leaves of transgenic plant and wild type detected by GUS staining. (I) PCR detection of transgenic plants. M, DL2000 marker; CK+, plasmid; CK-, non-transgenic plant; L1–L6, transgenic plants.

Identification of PeU3 Promoter and Used for Small Guide RNA Expression
Two endogenous U3 snRNA promoters were identified from the moso bamboo genome. The sgRNA sites targeting PH02Gene09948 and PH02Gene04757 were designed by http://skl.scau.edu.cn/targetdesign/ and constructed under the OsU3/PeU3.1/PeU3.2 promoter. The expression frame of U3:sgRNA was then introduced to pC1300-Ubi:Cas9 vector according to previously reported methods (Wang et al., 2015). The constructs were transformed to A. tumefaciens strain EHA105, and then, the calli were infected. DNA was extracted the from the resistant calli and amplified by PCR (primers: Cas9-F: 5′-GGCATAAGCCCGAGAACAT, Cas9-R: 5′-CAAAAGTTGCCTCCAGTAGTTC, 404 bp). The positive samples were sequenced using the Hi-TOM protocol (Liu et al., 2019).

CRISPR/Cas9 Genome Editing
To obtain stable transformed plants edited by CRISPR/Cas9, the homologous sequences of OsPDS were identified by BLAST searching the BambooGDB1. PCR primers were designed on the conserved regions of these two homologous sequences. The PCR products were sequenced by the Hi-TOM protocol to confirm the subgenomes. Conserved sgRNA sites in all copies were designed and driven by PeU3.1 promoter and then introduced into pC1300-Ubi:Cas9. Transgenic plants were obtained through the transformation process described above and tested by PCR amplification. The positive plants were sequenced using the Hi-TOM protocol. The primers used included PDS - F: CAAGCACTGAAAAGTAGTCACCGT and PDS - R: AATCCTAGAATTACATCAGACC (331 bp).

Phenotypic Observation by Transmission Electron Microscope
The leaves of albino mutants and wild types were cut into pieces less than 1 mm2 and fixed by 2.5% glutaraldehyde and 1% osmic acid. After dehydration with ethanol and acetone, the samples were embedded and cured. The tissues were then located using a semithin slicer (1 um) and sliced by an ultrathin slicer (70 nm). The sections were stained with 3% uranium acetate-lead citrate and observed by transmission electron microscope (JEOL l1230).

Results
Plant Regeneration From Immature Moso Bamboo Embryos
The immature embryos (Figure 1B) were separated from the seeds (Figure 1A) and cultured in the callus induction medium (Figure 1F). Preliminary experiments showed that the concentration of 2,4-D mainly affected the callus induction frequency. The embryos could germinate on the medium without any plant hormones, whereas germination was inhibited with the increase of 2,4-D concentration. The immature embryos remained in the induction medium for 10 days, where they began to swell and turn light yellow. Light yellow calli were induced on the MS medium with the addition of 1–6 mg⋅L–1 2,4-D for 3 weeks (Figures 1C,G). The highest induction frequency was around 60% when 4 mg⋅L–1 2,4-D was added to the MS medium. However, there was no significant change when the concentration was increased above 4 mg⋅L–1 (Figure 1L).

Light yellow calluses were subcultured on MS medium with low concentrations of 2, 4-D (0.1–1.0 mg⋅L–1) once every month. During this period, calluses in different states including yellow compact, white block, and white globular calli were produced. These calli could proliferate in large numbers (Figures 1D,H), and some of them (5%) could differentiate into plantlets immediately during subculture (Figure 1E). Various combinations of cytokinins and auxins were tested at different concentrations (Table 1). The frequency of shoot induction was about 34.5% on MS medium supplemented with 2.0 mg⋅L–1 BAP, 3.0 mg⋅L–1 ZT and 0.5 mg⋅L–1 NAA (Figure 1I). To further improve the shoot induction frequency, calli were pretreated with different concentrations of ABA and showed higher differentiation rate of 43% at 0.5 mg⋅L–1 ABA pretreatment (Figure 1M).

TABLE 1
www.frontiersin.org
Table 1. Effect of plant growth regulator on shoot induction of moso bamboo.

When the shoots grew to more than 1.5 cm, they were transferred to the rooting medium. The roots could be inducted on 1/2 MS basal medium supplemented with 2 mg⋅L–1 IBA. The rooting rate was about 95% at 3 weeks after induction (Figure 1J). The regenerated plants were transplanted into peat soil, and the survival rate was close to 100% (Figure 1K).

Genetic Transformation Mediated by A. tumefaciens
Large white calli were selected as the receptors for gene transformation. First, different concentrations of hygromycin (0–50 mg⋅L–1) were set up for optimization of the concentration of antibiotic for transformation selection. Some calli turned brown after culture on the medium containing hygromycin for 4 weeks. The browning calli could not grow and proliferate, whereas some slightly browning or non-browning calli could still grow new calli after being subcultured on the same medium for another 4 weeks. The survival ratio of calli decreased significantly with increased concentrations of hygromycin (Figure 2B). Finally, 40 mg⋅L–1 hygromycin was used to screen the putative transgenic plants.

According to the traditional transformation method, the calluses were infected in the bacterial suspension with concentrations of OD600 0.2–1.0 for 20 min. The GUS stain (Figure 2E) results showed that the transient expression frequency was increased with the concentration of Agrobacterium. The contamination rate of Agrobacterium also increased during the subsequent culture (Figure 2C). Therefore, OD600 0.6 was selected as the most suitable infection concentration. In addition, vacuum infiltration was performed to improve the transformation frequency. The transient expression frequency was increased by vacuum infiltration for 5–15 min. However, the calli treated by vacuum infiltration for 15 min showed a higher death rate (50%) in the subsequent selective culture (Figure 2D). It was speculated that a long period of vacuum infiltration may have caused serious damage to the calli. Therefore, soaking for 10 min followed by vacuum infiltration for 10 min was performed for Agrobacterium infection.

The transformed calli became brown, and new white calli grew from their mother calli after 1.5 months (Figure 2F). The resistant calli were successively subcultured for 3–4 months and recovered vigor for shoot differentiation. Finally, about 23 independent hygromycin-resistant plants were generated from 341 infected calli, of which 17 were positive by GUS and PCR (73.9%) (Figures 2G–I). The transformation efficiency was approximately 5%. It is important to confirm the transgenic nature of asexual clones from T0 transgenic lines. At least three clones of each transgenic line were tested by PCR and GUS staining. The PCR results were 100% positive and GUS was expressed in all plants (Figure 3). These results indicate that the transgenic nature is stable in the asexual reproduction of transgenic moso bamboo plants.

FIGURE 3
www.frontiersin.org
Figure 3. Detection of asexual clones from T0 transgenic lines. (A) Three asexual clones of a representative of transgenic line. Leaves of three shoots from each clone were detected by PCR and GUS staining. (B) The result of PCR detection. CK+, plasmid; WT, wild type; M, DNA marker (DL2000). (C) The result of GUS staining. WT, wild type.

PeU3 Promoter Used for Optimizing the CRISPR/Cas9 Genome-Editing System
To optimize the genome-editing efficiency in moso bamboo, two endogenous U3 snRNA promoters for driving sgRNA expression were identified. Similar to the OsU3 promoter, the conserved USE element and TATA-box were found in these two PeU3 promoters (Figure 4A). SgRNA sites targeting PH02Gene09948 and PH02Gene04757 were constructed under the OsU3/PeU3.1/PeU3.2 promoter and introduced to the expression vector pC1300-Ubi:Cas9 (Figure 4B). These six constructs were transformed into the calli of moso bamboo following the transformation methods described above. The DNA of 283 resistant calli screened for 1.5 months was extracted, and 198 positive samples (70%) were confirmed by PCR. Thirty samples per Ubi:Cas9-U3:sgRNA construct were sequenced using the Hi-TOM protocol (Liu et al., 2019). The results showed that the PeU3.1 and PeU3.2 promoters worked and also the OsU3 promoter. The PeU3.1 promoter showed higher efficiency (35–39%) when used to drive the gRNA expression for genome editing in moso bamboo (Figures 4E,F). The mutation type was mainly base deletion (Figures 4C,D).

FIGURE 4
www.frontiersin.org
Figure 4. Editing efficiency of two sgRNAs driven by OsU3/PeU3.1/PeU3.2 promoter. (A) Blast result of PeU3.1, PeU3.2, and OsU3 promoters. Red box showed USE element, TATA – box and transcriptional start site. (B) pC1300-Ubi:Cas9 vector containing sgRNA site driven by OsU3/PeU3.1/PeU3.2, respectively. (C,D) Mutation type of sgRNAs targeting PH02Gene09948 and PH02Gene04757. Dotted lines, base deletions; green lowercase letters, base insertions; red lowercase letters, base substitutions. (E,F) Frequency of the CRISPR/Cas9-induced mutations in target sites driven by OsU3/PeU3.1/PeU3.2, respectively.

Homozygous pds Mutants Were Obtained by CRISPR/Cas9 Genome Editing
Two homologous sequences of OsPDS were identified, named PePDS1 and PePDS2 (PH02Gene05482 and PH02Gene10404, respectively). The further amplified results showed that there were four copies on the moso bamboo genome. One conserved sgRNA site that targeted all copies was designed (Figure 5A). Finally, seven PCR positive lines (70%) were obtained by Agrobacterium-mediated transformation. Sequencing results confirmed that six lines (85.7%) were mutated at the sgRNA site. Three lines (42.9%; T0-2, T0-3, and T0-5) were putative homozygous pds1pds2 mutants (Figure 5B), which exhibited albino phenotypes (Figure 5C) and died during the growth period. However, no visible phenotypic change was observed in heterozygous mutants (T0-1, T0-4, and T0-6), which were mutated at sgRNA site of one or two copies (Figure 5B). Transmission electron microscopy revealed that the green leaves had intact chloroplasts, the thylakoids were arranged in an orderly manner, and the grana lamellae were clear (Figures 5D-i,ii), whereas there were few chloroplasts in the albino mutants and no stacking of thylakoids (Figures 5D-iii,iv).

FIGURE 5
www.frontiersin.org
Figure 5. Genome editing of PePDS gene by CRISPR/Cas9. (A) Genome structures of PePDS1 and PePDS2. Gray boxes, exons; black line, intron; red rectangle, sgRNA target site; red letters, sgRNA target regions; blue letters, PAM regions. (B) Mutations at sgRNA site of putative homozygous pds1pds2 lines (T0-2, T0-3, and T0-5) and a representative of heterozygous mutant (T0-1). Green lowercase letters, base insertions; dotted lines, base deletions. (C) Albino shoots and regenerated plant of homozygous pds1pds2 mutant (ii–iv). i, wild type. (D) Transmission electron microscope observation of leaves. i and ii, wild type. iii and iv, albino mutant. Red circle, chloroplasts; red arrow, thylakoid lamellae.

Discussion
Genetic engineering technology has been successfully applied to many plant species, but the lack of efficient regeneration system is the major bottleneck of its application in bamboo. There are many factors affecting the regeneration efficiency, among which genotype is the key factor. Because bamboo is mainly propagated by asexual reproduction, there are few bamboo varieties. At present, plant regeneration systems for bamboo have mostly been reported in sympodial bamboo species. The regeneration of grasses is more difficult than that of dicotyledonous plants due to the restriction of explants. Mature or immature embryos are commonly used for plant regeneration in grasses. There have been several reports on plant regeneration from zygotic embryos, such as B. arundinacea, D. latiflorus, D. strictus, and Otatea acuminata aztecorum (Mehta et al., 1982; Rao et al., 1985; Yeh and Chang, 1987; Woods et al., 1992). Only one case of a monopodial bamboo species showing plant regeneration has been reported to date. Plant regeneration from calli was induced from the mature seeds of P. edulis (Yuan et al., 2013), but the mature seeds were difficult to completely sterilize and no more than 5.0% of the calli were able to regenerate shoots.

Immature embryos are easier to sterilize, and calli can be induced from the scutellum with parenchyma cells. Regeneration systems from immature embryos have been widely established in rice, wheat, corn, and other gramineous crops (Özgen et al., 1998; Frame et al., 2011; Shimizu-Sato et al., 2020). In this study, although bamboo rarely blooms, immature seeds were collected from experienced bamboo farmers every year. The immature embryos were isolated and cultivated as explants to induce calli. It should be noted that even the seeds collected from the same bamboo tree did not develop completely synchronously. Embryos were too young nearly transparent without an obvious bud point, whereas embryos with high maturity were difficult to isolate from the hard endosperm and seed coat. These two types of embryos are not suitable for callus induction. Appropriate seeds appear plump, grayish-green, and the size of immature embryo is about 1.3 mm in diameter (Figures 1A,B). In addition to the type of explants, the basic medium, plant hormones, osmotic pressure, additives, pH, culture conditions, and other factors also affect the efficiency of plant regeneration. Through many preliminary experiments, we found that the concentration of 2,4-D mainly affected the callus induction frequency. As an auxin-like plant regulator, 2,4-D is widely used in callus and somatic embryo induction. The germination of embryos was inhibited with the increase of 2,4-D concentration and the highest frequency of callus induction reached around 60% with the addition of 4 mg⋅L–1 2,4-D in the MS medium. It is generally acknowledged that high concentrations of 2,4-D used in the callus induction stage may not be conducive to subsequent differentiation (Zheng and Konzak, 1999). After 3 weeks of induction, calli were subcultured on MS medium with low concentrations of 2, 4-D (0.1–1.0 mg⋅L–1). After long-term subculture, the calli could still maintain strong proliferation and differentiation ability.

Some embryogenic calli (5%) could differentiate into plantlets immediately on the proliferation medium. An optimized combination of cytokinins and auxins was selected to improve the shoot differentiation rate. Recently, transcriptome analysis showed that the expression levels of the majority of ABA-related genes were substantially altered during shoot induction in Ma bamboo, and the exogenous application of an optimized ABA concentration improved the shoot regeneration efficiency (Tu et al., 2021). Our results showed that the shoot differentiation frequency was significantly increased with ABA pretreatment in subculture stage. It is speculated that ABA may act as a “signal” in the formation of embryogenic calli, which needs to be further studied. In addition, it has been reported that some developmental regulators such as BBM, WUS, and GRF-GIF chimeras can accelerate shoot formation in both monocotyledons and dicotyledons (Lowe et al., 2018; Debernardi et al., 2020; Zhang et al., 2021). Next, we will study whether these regulators can further improve shoot differentiation in moso bamboo.

Obtaining stable transgenic plants through Agrobacterium mediated transformation is the main means of genetic transformation. Numerous factors, such as the plants genotype, types, and stages of the tissues infected, the strains of A. tumefaciens, the concentration of the inoculum, the type of vectors used, the tissue culture media, the selection markers, and the selective agents are of critical importance for achieving efficient transformation. As in rice and Ma bamboo, hygromycin phosphotransferase (HPT) was an efficient selection marker for moso bamboo transformation. We further optimized the Agrobacterium concentration and added vacuum infiltration for infection, which improved the transient expression efficiency. However, the main obstacle to transformation was that the regeneration ability of hygromycin-resistant calli was largely reduced and needed to recover for a long period before regenerating plants after the transformation of bamboo (Ye et al., 2017). Selection pressure is also a severe abiotic stress. Even the transformed cells expressing a selection marker gene tend to grow less vigorously on the media that contain a selective agent than on non-selective media (Hiei et al., 2014). AS in Ma bamboo, in this study, 8 months were needed for the whole transformation period. This period may be shortened by optimizing the transformation procedure in future research.

The expression of CRISPR in plants is typically achieved with a mixed dual-promoter system, in which the Cas protein is expressed by a Pol II promoter and a guide RNA is expressed by a Pol III promoter such as U6 or U3. The editing efficiency varies with the use of different U3/U6 promoters for driving sgRNA transcription. Ye et al. (2020) who compared the editing efficiency of three rice U6 promoters (OsU6a/OsU6b/OsU6c) using Ma bamboo protoplast system found that OsU6 showed higher editing efficiency. It is reported that species-specific U3/U6 promoters are much more efficient for driving sgRNA transcription and enhancing the editing efficiency of the CRISRP/Cas9 system (Feng et al., 2013; Sun et al., 2015; Long et al., 2018). For example, the genome-editing efficiency was 1.8–6.3 times higher than that obtained using AtU6-26 promoter when the sgRNA was driven by native GmU6-10 promoter in soybean (Sun et al., 2015). To optimize the genome-editing efficiency, two endogenous U3 snRNA promoters were identified from moso bamboo and used to drive sgRNA expression. The results showed that the PeU3.1 promoter exhibited higher efficiency, and it was used in the subsequent genome editing in moso bamboo.

Phytoene desaturase (PDS) is the primary rate-limiting enzyme that catalyzes the desaturation of colorless phytoene into ζ-carotene, which further converted into lycopene, a colorful compound in the carotenoid biosynthesis pathway (Bai et al., 2016). The deformation or knockout of PDS genes affects photosynthesis and carotenoid biosynthesis, which results in albinism and retarded plant growth (Tian, 2015). Therefore, the PDS gene has been used as a marker to detect the genome-editing efficiency in several plant species, such as A. thaliana, O. sativa, Nicotiana tabacum, and P. davidiana × P. bolleana, and so on (Feng et al., 2013; Baltes et al., 2014; Banakar et al., 2020; Wang et al., 2020). Three different PDS gene sequences, including two haplotypes of PdbPDS1 and one haplotype of PdbPDS2, were identified in P. davidiana × P. bolleana. The results showed that if more than two alleles of the two genes were edited, the transgenic plants appeared albino (Wang et al., 2020). Moso bamboo is considered to be an allotetraploid with high genotype heterozygosity (Guo et al., 2019; Zhao et al., 2021). For genome editing, the homologous and subgenome sequences should be considered to designate precise target sites. In this study, two homologous sequences, PePDS1 and PePDS2, were identified. The further amplified results showed that there were four copies of these two homologous sequences. Therefore, we designed one conserved gRNA site that targeted all copies. Finally, three transgenic lines of putative homozygous pds1pds2 mutants in the sgRNA site were obtained, which showed albino phenotypes. A precise and efficient CRISPR/Cas9-based gene-editing system was demonstrated for the first time in moso bamboo.

In summary, this study established the first reported immature embryo plant regeneration system and genetic transformation system in P. edulis, the most important monopodial bamboo species. The PeU3.1 snRNA promoter was used to drive sgRNA expression, and an efficient CRISPR/Cas9-based genome editing was demonstrated in moso bamboo. These technical systems will be conducive to gene functional validation and accelerate the breeding process of moso bamboo.

Data Availability Statement
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author/s.

Author Contributions
GQ and RZ conceived this project, designed the experiments, and interpreted the results. BH, HF, and KJ performed the experiments and analyzed the data. JX and YW helped to perform the experiments and collected the data. BH and GQ wrote the manuscript. All authors read and approved the submission of this manuscript.

Funding
This research was funded by the National Key Research and Development Program of China (Grant No. 2021YFD2200504) and the National Non-profit Institute Research Grant of Chinese Academy of Forestry (Grant No. CAFYBB2020ZB004).

Conflict of Interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s Note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Acknowledgments
We thank Kejian Wang from China National Rice Research Institute for providing the pC1300-Ubi:Cas9 plasmids. We also thank LetPub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript.

Supplementary Material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10 ... y-material

Supplementary Video 1 | Isolation of immature embryos from the seeds of moso bamboo.

Footnotes
^ http://www.bamboogdb.org/#/
References
Bai, C., Capell, T., Berman, J., Medina, V., Sandmann, G., Christou, P., et al. (2016). Bottlenecks in carotenoid biosynthesis and accumulation in rice endosperm are influenced by the precursor–product balance. Plant Biotechnol. J. 14, 195–205. doi: 10.1111/pbi.12373

PubMed Abstract | CrossRef Full Text | Google Scholar

Baltes, N. J., Gil-Humanes, J., Cermak, T., Atkins, P. A., and Voytas, D. F. (2014). DNA replicons for plant genome engineering. Plant Cell 26, 151–163. doi: 10.1105/tpc.113.119792

PubMed Abstract | CrossRef Full Text | Google Scholar

Banakar, R., Schubert, M., Collingwood, M., Vakulskas, C., Eggenberger, A. L., and Wang, K. (2020). Comparison of CRISPR-Cas9/Cas12a ribonucleoprotein complexes for genome editing efficiency in the rice phytoene Desaturase (OsPDS) Gene. Rice 13:4. doi: 10.1186/s12284-019-0365-z

PubMed Abstract | CrossRef Full Text | Google Scholar

Bedell, V. M., Wang, Y., Campbell, J. M., Poshusta, T. L., Starker, C. G., Krug, R. G. II et al. (2012). In vivo genome editing using a high-efficiency TALEN system. Nature 491, 114–118.

Google Scholar

Belhaj, K., Chaparro-Garcia, A., Kamoun, S., and Nekrasov, V. (2013). Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods 9:39. doi: 10.1186/1746-4811-9-39

PubMed Abstract | CrossRef Full Text | Google Scholar

Bibikova, M., Beumer, K., Trautman, J. K., and Carroll, D. (2003). Enhancing gene targeting with designed zinc finger nucleases. Science 300, 764–764. doi: 10.1126/science.1079512

PubMed Abstract | CrossRef Full Text | Google Scholar

Cong, L., Ran, F. A., Cox, D., Lin, S. L., Barretto, R., Habib, N., et al. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–823. doi: 10.1126/science.1231143

PubMed Abstract | CrossRef Full Text | Google Scholar

Dai, X., Yang, X., Wang, C., Fan, Y., Xin, S., and Hua, Y. (2021). CRISPR/Cas9-mediated genome editing in Hevea brasiliensis. Ind. Crops Prod. 164:113418. doi: 10.1016/j.indcrop.2021.113418

CrossRef Full Text | Google Scholar

Debernardi, J. M., Tricoli, D. M., Ercoli, M. F., Hayta, S., Ronald, P., Palatnik, J. F., et al. (2020). A GRF–GIF chimeric protein improves the regeneration efficiency of transgenic plants. Nat. Biotechnol. 38, 1274–1279. doi: 10.1038/s41587-020-0703-0

PubMed Abstract | CrossRef Full Text | Google Scholar

Feng, Z., Zhang, B., Ding, W., Liu, X., Yang, D. L., Wei, P., et al. (2013). Efficient genome editing in plants using a CRISPR/Cas system. Cell Res. 23, 1229–1232. doi: 10.1038/cr.2013.114

PubMed Abstract | CrossRef Full Text | Google Scholar

Frame, B., Main, M., Schick, R., and Wang, K. (2011). Genetic transformation using maize immature zygotic embryos. Methods Mol. Biol. 710, 327–341. doi: 10.1007/978-1-61737-988-8_22

PubMed Abstract | CrossRef Full Text | Google Scholar

Ge, W., Zhang, Y., Cheng, Z. C., Hou, D., Li, X. P., and Gao, J. (2017). Main regulatory pathways, key genes and microRNAs involved in flower formation and development of Moso bamboo (Phyllostachys edulis). Plant Biotechnol. J. 15, 82–96. doi: 10.1111/pbi.12593

PubMed Abstract | CrossRef Full Text | Google Scholar

Guo, Z., Ma, P., Yang, G., Hu, J., and Li, D. (2019). Genome sequences provide insights into the reticulate origin and unique traits of woody bamboos. Mol. Plant 12, 1353–1365. doi: 10.1016/j.molp.2019.05.009

PubMed Abstract | CrossRef Full Text | Google Scholar

Hiei, Y., Ishida, Y., and Komari, T. (2014). Progress of cereal transformation technology mediated by Agrobacterium tumefaciens. Front. Plant Sci. 5:628. doi: 10.3389/fpls.2014.00628

PubMed Abstract | CrossRef Full Text | Google Scholar

Lee, K., Zhang, Y. X., Kleinstiver, B. P., Guo, J. A., Aryee, M. J., Miller, J., et al. (2018). Activities and specificities of CRISPR/Cas9 and Cas12a nucleases for targeted mutagenesis in maize. Plant Biotechnol. J. 17, 362–372. doi: 10.1111/pbi.12982

PubMed Abstract | CrossRef Full Text | Google Scholar

Li, X., Jiang, D. H., Yong, K. L., and Zhang, D. B. (2007). Varied transcriptional efficiencies of multiple Arabidopsis U6 small nuclear RNA genes. J. Integr. Plant Biol. 49, 222–229. doi: 10.1111/j.1744-7909.2007.00393.x

CrossRef Full Text | Google Scholar

Li, Y., and Fu, H. (2021). Global plastic ban policy and development opportunities of bamboo industry. World Bamboo Rattan 19, 1–7.

Google Scholar

Liang, Z., Chen, K. L., Li, T. D., Zhang, Y., Wang, Y. P., Zhao, Q., et al. (2017). Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes. Nat. Commun. 8:14261. doi: 10.1038/ncomms14261

PubMed Abstract | CrossRef Full Text | Google Scholar

Liu, Q., Wang, C., Jiao, X., Zhang, H., and Song, L. (2019). Hi-TOM: a platform for high-throughput tracking of mutations induced by CRISPR/Cas systems. Sci. China Life Sci. 62, 1–7. doi: 10.1007/s11427-018-9402-9

PubMed Abstract | CrossRef Full Text | Google Scholar

Long, L., Guo, D. D., Gao, W., Yang, W. W., Hou, L. P., Ma, X. N., et al. (2018). Optimization of crispr/cas9 genome editing in cotton by improved sgrna expression. Plant Methods 14:85. doi: 10.1186/s13007-018-0353-0

PubMed Abstract | CrossRef Full Text | Google Scholar

Lowe, K., La Rota, M., Hoerster, G., Hastings, C., Wang, N., Chamberlin, M., et al. (2018). Rapid genotype “independent” Zea mays L. (maize) transformation via direct somatic embryogenesis. In Vitro Cell. Dev. Biol. Plant 54, 240–252. doi: 10.1007/s11627-018-9905-2

PubMed Abstract | CrossRef Full Text | Google Scholar

Mehta, U., Ramanuja Rao, I., and Mohan Ram, H. (1982). “Somatic embryogenesis in bamboo,” in Proceedings of the 1982 5th International Congress of Plant Tissue and Cell Culture, ed. A. Fujiwara (Tokyo: Japanese Association for Plant Tissue Culture), 109–110. doi: 10.1078/0176-1617-01219

PubMed Abstract | CrossRef Full Text | Google Scholar

Özgen, M., Türet, M., Altınok, S., and Sancak, C. (1998). Efficient callus induction and plant regeneration from mature embryo culture of winter wheat (Triticum aestivum L.) genotypes. Plant Cell Rep. 18, 331–335. doi: 10.1007/s002990050581

PubMed Abstract | CrossRef Full Text | Google Scholar

Papikian, A., Liu, W. L., Gallego-Bartolomé, J., and Jacobsen, S. E. (2019). Site-specific manipulation of Arabidopsis loci using CRISPR-Cas9 SunTag systems. Nat. Commun. 10:729. doi: 10.1038/s41467-019-08736-7

PubMed Abstract | CrossRef Full Text | Google Scholar

Peng, Z., Lu, Y., Li, L., Zhao, Q., Feng, Q., Gao, Z., et al. (2013). The draft genome of the fast-growing non-timber forest species moso bamboo (Phyllostachys heterocycla). Nat. Genet. 45, 456–463. doi: 10.1038/ng.2569

PubMed Abstract | CrossRef Full Text | Google Scholar

Qiao, G., Li, H., Liu, M., Jiang, J., Yin, Y., Zhang, L., et al. (2013). Callus induction and plant regeneration from anthers of Dendrocalamus latiflorus Munro. In Vitro Cell. Dev. Biol. Plant 49, 375–382.

Google Scholar

Qiao, G., Yang, H., Zhang, L., Han, X., Liu, M., Jiang, J., et al. (2014). Enhanced cold stress tolerance of transgenic Dendrocalamus latiflorus Munro (Ma bamboo) plants expressing a bacterial CodA gene. In Vitro Cell. Dev. Biol. Plant 50, 385–391. doi: 10.1007/s11627-013-9591-z

CrossRef Full Text | Google Scholar

Rao, I. U., Rao, I. V. R., and Narang, V. (1985). Somatic embryogenesis and regeneration of plants in the bamboo Dendrocalamus strictus. Plant Cell Rep. 4, 191–194. doi: 10.1007/BF00269286

PubMed Abstract | CrossRef Full Text | Google Scholar

Shimizu-Sato, S., Tsuda, K., Nosaka-Takahashi, M., Suzuki, T., and Sato, Y. (2020). Agrobacterium-mediated genetic transformation of wild Oryza species using immature embryos. Rice 13:33. doi: 10.1186/s12284-020-00394-4

PubMed Abstract | CrossRef Full Text | Google Scholar

Sun, X., Hu, Z., Chen, R., Jiang, Q., Song, G., Zhang, H., et al. (2015). Targeted mutagenesis in soybean using the CRISPR-Cas9 system. Sci. Rep. 5:10342. doi: 10.1038/srep10342

PubMed Abstract | CrossRef Full Text | Google Scholar

Tian, L. (2015). Recent advances in understanding carotenoid-derived signaling molecules in regulating plant growth and development. Front. Plant Sci. 6:790. doi: 10.3389/fpls.2015.00790

PubMed Abstract | CrossRef Full Text | Google Scholar

Tsay, H. S., Yeh, C. C., and Hsu, J. Y. (1990). Embryogenesis and plant regeneration from anther culture of bamboo (Sinocalamus latiflora (Munro) McClure). Plant Cell Rep. 9, 349–351. doi: 10.1007/BF00232396

PubMed Abstract | CrossRef Full Text | Google Scholar

Tu, M., Wang, W., Yao, N., Cai, C., Liu, Y., Lin, C., et al. (2021). The transcriptional dynamics during de novo shoot organogenesis of Ma bamboo (Dendrocalamus latiflorus Munro): implication of the contributions of the abiotic stress response in this process. Plant J. 107, 1513–1532. doi: 10.1111/tpj.15398

PubMed Abstract | CrossRef Full Text | Google Scholar

Wang, C., Shen, L., Fu, Y., Yan, C., and Wang, K. (2015). A simple CRISPR/Cas9 system for multiplex genome editing in rice. J. Genet. Genomics 42, 703–706. doi: 10.1016/j.jgg.2015.09.011

PubMed Abstract | CrossRef Full Text | Google Scholar

Wang, J., Wu, H., Chen, Y., and Yin, T. (2020). Efficient CRISPR/Cas9-mediated gene editing in an interspecific hybrid poplar with a highly heterozygous genome. Front. Plant Sci. 11:996. doi: 10.3389/fpls.2020.00996

PubMed Abstract | CrossRef Full Text | Google Scholar

Wang, K. L., Zhang, Y., Zhang, H. M., Lin, X. C., Xia, R., Song, L., et al. (2021). Micrornas play important roles in regulating rapid growth of the phyllostachys edulis culm internode. New Phytol. 231, 2215–2230. doi: 10.1111/nph.17542

PubMed Abstract | CrossRef Full Text | Google Scholar

Wei, Q., Chen, J., Lin, G., Ding, Y., Cao, J., Feng, J., et al. (2017). Exploring key cellular processes and candidate genes regulating the primary thickening growth of moso underground shoots. New Phytol. 214, 81–96. doi: 10.1111/nph.14284

PubMed Abstract | CrossRef Full Text | Google Scholar

Woods, S. H., Phillips, G. C., Woods, J. E., and Collins, G. B. (1992). Somatic embryogenesis and plant regeneration from zygotic embryo explants in Mexican weeping bamboo, Otatea acuminata aztecorum. Plant Cell Rep. 11, 257–261. doi: 10.1007/BF00235077

PubMed Abstract | CrossRef Full Text | Google Scholar

Yang, K., Li, L., Lou, Y., Zhu, C., Li, X., and Gao, Z. (2021). A regulatory network driving shoot lignification in rapidly growing bamboo. Plant Physiol. 187, 900–916. doi: 10.1093/plphys/kiab289

PubMed Abstract | CrossRef Full Text | Google Scholar

Ye, S., Cai, C., Ren, H., Wang, W., Xiang, M., Tang, X., et al. (2017). An Efficient Plant Regeneration and Transformation System of Ma Bamboo (Dendrocalamus latiflorus Munro) started from young shoot as explant. Front. Plant Sci. 8:1298. doi: 10.3389/fpls.2017.01298

PubMed Abstract | CrossRef Full Text | Google Scholar

Ye, S., Chen, G., Kohnen, M. V., Wang, W., and Zhu, Q. (2020). Robust CRISPR/Cas9 mediated genome editing and its application in manipulating plant height in the first generation of hexaploid Ma bamboo (Dendrocalamus latiflorus Munro). Plant Biotechnol. J. 18, 1501–1503. doi: 10.1111/pbi.13320

PubMed Abstract | CrossRef Full Text | Google Scholar

Yeh, M., and Chang, W. C. (1986a). Plant regeneration through somatic embryogenesis in callus culture of green bamboo (Bambusa oldhamii Munro). Theor. Appl. Genet. 73, 161–163. doi: 10.1007/BF00289269

PubMed Abstract | CrossRef Full Text | Google Scholar

Yeh, M., and Chang, W. C. (1986b). Somatic embryogenesis and subsequent plant regeneration from inflorescence callus of Bambusa beecheyana Munro var. beecheyana. Plant Cell Rep. 5, 409–411. doi: 10.1007/BF00269628

PubMed Abstract | CrossRef Full Text | Google Scholar

Yeh, M., and Chang, W. C. (1987). Plant regeneration via somatic embryogenesis in mature embryo-derived callus culture of Sinocalamus latiflora (Munro) McClure. Plant Sci. 51, 93–96. doi: 10.1016/0168-9452(87)90224-x

CrossRef Full Text | Google Scholar

Yuan, J., Yue, J., Wu, X., and Gu, X. (2013). Protocol for callus induction and somatic embryogenesis in moso bamboo. PLoS One 8:e81954. doi: 10.1371/journal.pone.0081954

PubMed Abstract | CrossRef Full Text | Google Scholar

Zang, Q., Zhou, L., Zhuge, F., Yang, H., Wang, X., and Lin, X. (2016). Callus induction and regeneration via shoot tips of Dendrocalamus hamiltonii. Springerplus 5:1799. doi: 10.1186/s40064-016-3520-7

PubMed Abstract | CrossRef Full Text | Google Scholar

Zhang, J. S., Zhang, H., Botella, J. R., and Zhu, J. K. (2018). Generation of new glutinous rice by CRISPR/Cas9-targeted mutagenesis of the Waxy gene in elite rice varieties. J. Integr. Plant Biol. 60, 369–375. doi: 10.1111/jipb.12620

PubMed Abstract | CrossRef Full Text | Google Scholar

Zhang, X., Xu, G., Cheng, C., Lei, L., and Su, J. (2021). Establishment of an agrobacterium-mediated genetic transformation and CRISPR/Cas9-mediated targeted mutagenesis in hemp (Cannabis Sativa L.). Plant Biotechnol. J. 19, 1979–1987. doi: 10.1111/pbi.13611

PubMed Abstract | CrossRef Full Text | Google Scholar

Zhang, Y., Liang, Z., Zong, Y., Wang, Y., Liu, J., Chen, K., et al. (2016). Efficient and transgene-free genome editing in wheat through transient expression of CRISPR/Cas9 DNA or RNA. Nat. Commun. 7:12617. doi: 10.1038/ncomms12617

PubMed Abstract | CrossRef Full Text | Google Scholar

Zhao, H., Gao, Z., Wang, L., Wang, J., Wang, S., Fei, B., et al. (2018). Chromosome-level reference genome and alternative splicing atlas of moso bamboo (Phyllostachys edulis). Gigascience 7:giy115. doi: 10.1093/gigascience/giy115

PubMed Abstract | CrossRef Full Text | Google Scholar

Zhao, H., Sun, S., Ding, Y., Wang, Y., Fan, G., Sun, H., et al. (2021). Analysis of 427 genomes reveals moso bamboo population structure and genetic basis of property traits. Nat. Commun. 12:5466. doi: 10.1038/s41467-021-25795-x

PubMed Abstract | CrossRef Full Text | Google Scholar

Zheng, M. Y., and Konzak, C. F. (1999). Effect of 2,4-dichlorophenoxyacetic acid on callus induction and plant regeneration in anther culture of wheat (Triticum aestivum L.). Plant Cell Rep. 19, 69–73. doi: 10.1007/s002990050712

PubMed Abstract | CrossRef Full Text | Google Scholar

Zhou, G., Meng, C., Jiang, P., and Xu, Q. (2011). Review of carbon fixation in bamboo forests in China. Bot. Rev. 77:262.

Google Scholar

Keywords: Phyllostachys edulis, plant regeneration, genetic transformation, genome editing, immature embryo culture

Citation: Huang B, Zhuo R, Fan H, Wang Y, Xu J, Jin K and Qiao G (2022) An Efficient Genetic Transformation and CRISPR/Cas9-Based Genome Editing System for Moso Bamboo (Phyllostachys edulis). Front. Plant Sci. 13:822022. doi: 10.3389/fpls.2022.822022

Received: 25 November 2021; Accepted: 17 January 2022;
Published: 11 February 2022.

Edited by:

Peng Zhang, Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences (CAS), China
Reviewed by:

Kan Wang, Iowa State University, United States
Jitesh Kumar, University of Minnesota Twin Cities, United States
Weiguo Zhang, Northwest University, China
Copyright © 2022 Huang, Zhuo, Fan, Wang, Xu, Jin and Qiao. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

*Correspondence: Guirong Qiao, gr_q1982@163.com

†These authors have contributed equally to this work

Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Write a comment...
Add
PEOPLE ALSO LOOKED AT
Comparative Transcriptome Analysis Reveals Differential Regulation of Flavonoids Biosynthesis Between Kernels of Two Pecan Cultivars
Chengcai Zhang, Huadong Ren, Xiaohua Yao, Kailiang Wang and Jun Chang

How Stress Affects Your Budget—Stress Impacts on Starch Metabolism
Camila Ribeiro, Mark Stitt and Carlos Takeshi Hotta

SLDMS: A Tool for Calculating the Overlapping Regions of Sequences
Yu Chen, DongLiang You, TianJiao Zhang and GuoHua Wang

Prediction and Utilization of Malondialdehyde in Exotic Pine Under Drought Stress Using Near-Infrared Spectroscopy
Yini Zhang, Qifu Luan, Jingmin Jiang and Yanjie Li

Salt-Specific Gene Expression Reveals Elevated Auxin Levels in Arabidopsis thaliana Plants Grown Under Saline Conditions
Lee Cackett, Carlo Vittorio Cannistraci, Stuart Meier, Paul Ferrandi, Aleš Pěnčík, Chris Gehring, Ondřej Novák, Robert A. Ingle and Lara Donaldson



Suggest a Research Topic >

About Frontiers
Institutional Membership
Books
News
Frontiers' social media
Contact
Carrières
Nous faire parvenir
Bulletin
Centre d'aide
termes et conditions
Politique de confidentialité
© 2007 - 2022 Frontiers Media SA Tous droits réservés


Répondre
  • Sujets similaires
    Réponses
    Vues
    Dernier message

Retourner vers « Les semis »